Monday: SWBAT: create a skit, poem, or song that show that they understand endosymbiosis.
1.) Endosymbiosis Work
2.) Classifying Life
3.) Tree of LIfe Notes
Tuesday: SWBAT: relate the kingdoms of life to natural selection and evolution.
1.) Quiz
2) Endosymbiosis Present
Wednesday: SWBAT: relate the kingdoms of life to natural selection and evolution.
1.) Reclassify LIfe based on previous notes.
2.) Bacteria Game
Thursday: SWBAT: Experiment to determine sensitivities of isopods.
1.) Rolly Polly Experiment
Friday: SWBAT: self-assess their knowledge of standards.
Standards Reading:
Friday, March 9, 2012
Sunday, March 4, 2012
Protein Structure, Function, PSA's, Well Water Testing
Monday
Goal: Students will create a public service announcement related to protecting your protein.
1.) Amino Acid Role Play
2.) Protein Structure and Function PPT.
3.) Public Service Announcement Work.
Students connect cell parts and functions to some other operation (anything but school)
Tuesday:
1.) First Protein Experiment: Room Temp, Boiled, Frozen=As a class
2.) Acting out Public Service Announcements.
3.) Set up second protein experiment.
Wednesday:
Frontline Football Video
Thursday:
Check Second Protein Experiment
Standards Reading
Friday: Nitrates in well-water reading Fugates of Kentucky and Lagrange County Article.
Monday: Go over cell parts and places in the classroom activity.
Wednesday: Standards Reading and Completion of Self Evaluation.
Thursday:
Protein Sensitivity with Gas Pressure monitors. (Control Potatos, Acid Potatos)
Friday:
Protect your proteins ad
Monday:
Present protect your proteins ad.
Goal: Students will create a public service announcement related to protecting your protein.
1.) Amino Acid Role Play
2.) Protein Structure and Function PPT.
3.) Public Service Announcement Work.
Students connect cell parts and functions to some other operation (anything but school)
Tuesday:
1.) First Protein Experiment: Room Temp, Boiled, Frozen=As a class
2.) Acting out Public Service Announcements.
3.) Set up second protein experiment.
Wednesday:
Frontline Football Video
Thursday:
Check Second Protein Experiment
Standards Reading
Friday: Nitrates in well-water reading Fugates of Kentucky and Lagrange County Article.
Monday: Go over cell parts and places in the classroom activity.
Wednesday: Standards Reading and Completion of Self Evaluation.
Thursday:
Protein Sensitivity with Gas Pressure monitors. (Control Potatos, Acid Potatos)
Friday:
Protect your proteins ad
Monday:
Present protect your proteins ad.
Friday, February 24, 2012
Stem Cells and Protein Sensitivity
Goal: Students will describe how stem cells differentiate.
Notes: Gametes combine in fertilization, Mitosis, Differentiation.
Vocabulary: Differentiation, Stem Cell, Totipotent Stem Cell, Pleuripotent stem cell.
Stem Cell/Embryology videos from Teachers Domain.
Wednesday
Goal: Students will describe process of differentiation.
-Review Notes of fertilization, mitosis, differentiation.
-Stem Cell Powerpoint Pyramid
-Stem Cell Guy Paperwork and Complete with computers.
Thursday:
Goal: Students will compare stem cell differentiation with a sports team.
1.) Students work in pairs on Stem Cell Basketball Worksheet.
2.) Students complete white board showing another similar differentiation situation.
Goal: Switched to Thursday: Students will describe debate over stem cell usage in research.
Friday
-Start with frozen embryo in family scenario.
FRONTLINE STEM CELL Video start.
Monday
Goal: Students will describe debate over stem cell usage in research.
Finish Frontline Video on Stem Cells.
Tuesday
Goal: Students connect cell parts and functions to some other operation (anything but school)
Wednesday: Standards Reading and Completion of Self Evaluation.
Thursday:
Protein Sensitivity with Gas Pressure monitors. (Control Potatos, Acid Potatos)
Friday:
Protect your proteins ad
Monday:
Present protect your proteins ad.
Thursday, February 16, 2012
Genetics, meiosis, into Stem Cells.
Friday: Exploring Next Generation
Monday: Karyotyping Chart and Websites
GOAL: Describe how karyotyping works to determine chromosomal abnormalities.
1.) Show sex determination punnett square. Show abnormalities with sex determination.
2.) Have students complete online karyotypes to determine abnormalities.
First Complete Utah Karyotype
Second Complete Explorelearning.com Gizmo Karyotype: Figure out one person.
Tuesday: Snow Day
Wednesday: Review Mitosis, Meiosis, Punnett Squares.
Thursday: Quiz, Stem Cells Start notes.
Friday: Go Go Stem Cells.
Monday; Stem Cell similar basketball situations and whiteboarding.
Tuesday: Cell Part Review for neurotransmitter role play.
Wednesday: Stem Cell Scenario and Stem Cell Video (Frontline)
Thursday: Frontline Video Finish.
Friday:
Monday: Karyotyping Chart and Websites
GOAL: Describe how karyotyping works to determine chromosomal abnormalities.
1.) Show sex determination punnett square. Show abnormalities with sex determination.
2.) Have students complete online karyotypes to determine abnormalities.
First Complete Utah Karyotype
Second Complete Explorelearning.com Gizmo Karyotype: Figure out one person.
Tuesday: Snow Day
Wednesday: Review Mitosis, Meiosis, Punnett Squares.
Thursday: Quiz, Stem Cells Start notes.
Friday: Go Go Stem Cells.
Monday; Stem Cell similar basketball situations and whiteboarding.
Tuesday: Cell Part Review for neurotransmitter role play.
Wednesday: Stem Cell Scenario and Stem Cell Video (Frontline)
Thursday: Frontline Video Finish.
Friday:
Wednesday, February 1, 2012
Genetics and Meiosis
Monday
Goal: Connect experimental results to genetic explanations.
1.) Mouse Gizmo Experiments
-Describe Parents, hypothesis, results, and conclusion.
2.) Genetics Exploration with Mice and Test experiments. Go through...
a.) Pure white x Pure Black
b.) Pure white x pure white
c.) pure black x pure black
d.) cross breed black x cross breed black
3.) Whiteboard predictions of white and heterozygous black mouse.
4.) Start Vocabulary descriptions.
Mendel Experiments Story Telling about mating.
Tuesday: Goal: Use appropriate terminology to describe genetic inheritance.
Variations importance with Darwin's Challenge
1.) Review: 46 chromosomes in each of our cells, 23 from mom, 23 from dad. Show gametes coming together.
Homologous Chromosomes in Somatic Cells, genes on chromosomes.
2.) Vocabulary: Genotype, Phenotype, Allele, Gene, Gene Activation, Gene Suppression, Dominant, Recessive, Heterozygous, hybrid, carrier, Homozygous, pure breed, F1, F2, Youtube Genetics Playlist.
3.) Utah "Observable Traits" Slideshow applying traits information. Create a Table of trait, phenotypes, me, mom, dad, brothers, sisters.
-9 Traits.
Observable Traits Chart for this activity. http://www.sonic.net/~nbs/projects/bio115l/form.html
a
Wednesday
Meiosis with paper chromosomes and Punnet Square problems with the one mouse traits.
Meiosis Notes
Thursday
Goal: Connect experimental results to genetic explanations.
1.) Vocabulary Review, with pieces of paper.
2.) Punnet Square Teaching how to use (Show with a cross between BB and bb, then between Bb and Bb)
3.) Chicken Gizmo Experiments.
-Describe parents, hypothesis, results, and conclusion, write a punnett square to describe 2 situations and compare the punnett square with the reality.
4.) Share results.
Friday:
Goal: Connect experimental results to genetic explanations.
1.) Vocabulary Review
2.) Punnet Square Teaching how to use (Show with a cross between BB and bb, then between Bb and Bb)
3.) Chicken Gizmo Experiments.
-Describe parents, hypothesis, results, and conclusion, write a punnett square to describe 2 situations and compare the punnett square with the reality.
4.) Share results.
5.) Sex chromosome punnett square.
Wednesday: GOAL: Students describe Egg donation process and ethics.
1.) Article and Scenario.
Monday: GOAL: describe differences between mitosis and meiosis.
1.) Punnett Square Practice Problem.
2.) Mitosis vs. Meiosis around room.
3.) Youtube Genetics Playlist on jgensic's channel.
4.) Lecture: Sex determination.
5.) Sex chromosome problems. XXX, XO, XYY, XXY
: Describe how karyotyping works to determine chromosomal abnormalities.
1.) Show sex determination punnett square. Show abnormalities with sex determination.
2.) Have students complete online karyotypes to determine abnormalities.
First Complete Utah Karyotype
Second Complete Explorelearning.com Gizmo Karyotype: Figure out one person.
Tuesday:
-Meiosis "Independent Assortment" with pennies
Wednesday:
-Cystic Fibrosis Scenario
Thursday:
-Meiosis with your own chromosomes and combination of gametes.
-Mitosis vs. Meiosis Around the room.
Friday:
: demonstrate meiosis with paper chromosomes.
-Explore Next Generation
Monday:
-Go over genetics study guides, variation.
-Nicotine Addiction Pedigree.
Tuesday:
Vocabulary Review, Nicotine Addiction Pedigree Investigator.
Wednesday: Genetics Test
Thursday: Stem Cell Start Test.
Goal: Describe Mendel's experiments, describe the process of meiosis.
1.) Mendels's Experiments interactive http://www2.edc.org/weblabs/Mendel/mendel.html
2.) Doing Punnett Squares around the room.
Monday:
Going into stem cells, embryo development, after meiosis in terms of organismal.
Goal: Connect experimental results to genetic explanations.
1.) Mouse Gizmo Experiments
-Describe Parents, hypothesis, results, and conclusion.
2.) Genetics Exploration with Mice and Test experiments. Go through...
a.) Pure white x Pure Black
b.) Pure white x pure white
c.) pure black x pure black
d.) cross breed black x cross breed black
3.) Whiteboard predictions of white and heterozygous black mouse.
4.) Start Vocabulary descriptions.
Mendel Experiments Story Telling about mating.
Tuesday: Goal: Use appropriate terminology to describe genetic inheritance.
Variations importance with Darwin's Challenge
1.) Review: 46 chromosomes in each of our cells, 23 from mom, 23 from dad. Show gametes coming together.
Homologous Chromosomes in Somatic Cells, genes on chromosomes.
2.) Vocabulary: Genotype, Phenotype, Allele, Gene, Gene Activation, Gene Suppression, Dominant, Recessive, Heterozygous, hybrid, carrier, Homozygous, pure breed, F1, F2, Youtube Genetics Playlist.
3.) Utah "Observable Traits" Slideshow applying traits information. Create a Table of trait, phenotypes, me, mom, dad, brothers, sisters.
-9 Traits.
Observable Traits Chart for this activity. http://www.sonic.net/~nbs/projects/bio115l/form.html
a
Wednesday
Meiosis with paper chromosomes and Punnet Square problems with the one mouse traits.
Meiosis Notes
Thursday
Goal: Connect experimental results to genetic explanations.
1.) Vocabulary Review, with pieces of paper.
2.) Punnet Square Teaching how to use (Show with a cross between BB and bb, then between Bb and Bb)
3.) Chicken Gizmo Experiments.
-Describe parents, hypothesis, results, and conclusion, write a punnett square to describe 2 situations and compare the punnett square with the reality.
4.) Share results.
Friday:
Goal: Connect experimental results to genetic explanations.
1.) Vocabulary Review
2.) Punnet Square Teaching how to use (Show with a cross between BB and bb, then between Bb and Bb)
3.) Chicken Gizmo Experiments.
-Describe parents, hypothesis, results, and conclusion, write a punnett square to describe 2 situations and compare the punnett square with the reality.
4.) Share results.
5.) Sex chromosome punnett square.
Wednesday: GOAL: Students describe Egg donation process and ethics.
1.) Article and Scenario.
Monday: GOAL: describe differences between mitosis and meiosis.
1.) Punnett Square Practice Problem.
2.) Mitosis vs. Meiosis around room.
3.) Youtube Genetics Playlist on jgensic's channel.
4.) Lecture: Sex determination.
5.) Sex chromosome problems. XXX, XO, XYY, XXY
: Describe how karyotyping works to determine chromosomal abnormalities.
1.) Show sex determination punnett square. Show abnormalities with sex determination.
2.) Have students complete online karyotypes to determine abnormalities.
First Complete Utah Karyotype
Second Complete Explorelearning.com Gizmo Karyotype: Figure out one person.
Tuesday:
-Meiosis "Independent Assortment" with pennies
Wednesday:
-Cystic Fibrosis Scenario
Thursday:
-Meiosis with your own chromosomes and combination of gametes.
-Mitosis vs. Meiosis Around the room.
Friday:
: demonstrate meiosis with paper chromosomes.
-Explore Next Generation
Monday:
-Go over genetics study guides, variation.
-Nicotine Addiction Pedigree.
Tuesday:
Vocabulary Review, Nicotine Addiction Pedigree Investigator.
Wednesday: Genetics Test
Thursday: Stem Cell Start Test.
Goal: Describe Mendel's experiments, describe the process of meiosis.
1.) Mendels's Experiments interactive http://www2.edc.org/weblabs/Mendel/mendel.html
2.) Doing Punnett Squares around the room.
Monday:
Going into stem cells, embryo development, after meiosis in terms of organismal.
Thursday, January 5, 2012
Molecules, DNA Replication, Cell Cycle, DNA to mRNA to Protein, Genetics, Meiosis
Friday: Cell Chemistry
1.) Quick ppt. review of macromolecules
2.) DNA Structure and Function (Put together as two groups racing)
3.) DNA Replication Steps
Monday: Cell Chemistry
1.) DNA Replication Races (Role Play): Replication Vocabulary.
2.) Causes of Mutation-Notes
3.) Break out computers for Nobel Prize DNA Replication races.
4.) Around the Room Macromolecules classification.
Tuesday:
1.) Start Cell Cycle Notes in Notebook Using Flipchart
2.) Vocab and Notes
Wednesday:
1.) Cell Cycle with Paper
2.) Cell Cycle Nobel Prize Interactive
3.) Cell Cycle Role Play
Monday
1.) Cell Cycle with Paper
2.) Cancer Types and steps research
3.) HHMI Videos on Cancer
Tuesday
1.) Individual Cancer Research
2.) Types/Cause/Etc.
Wednesday:
Cell Cycle, Molecule Types, and Cancer Study Guide
Thursday: Cell Cycle and Cancer Test
Friday and Monday
Tay Sachs Disease:
Symptoms: relentless deterioration of mental and physical abilities occurs. The child becomes blind, deaf, and unable to swallow. Muscles begin to atrophy and paralysis sets in. Death usually occurs before the age of 4. What do you think causes this? Most common among Jewish people.
Goal: Students describe how DNA provides template for proteins.
1.) DNA controls a cell, how?
-It uses the force to control actions.
-It provides a code that determines the structure of lipids that control reactions throughout the cell.
-It provides a code that determines the structure of proteins that control reactions throughout the cell.
-It provides a code that determines the structure of carbohydrates the control reactions throughout the cell.
FACTS:
DNA too large to get out of the nucleus. But still controls the cell. How?
2.) Transcription and Translation Videos HHMI.
3.) Translation and Transcription Notes.
Step 1: Cell gets a signal that a certain protein needs to be made.
Step 2: DNA is unwound and transcribed into a mRNA molecule. (gene activation)
Step 3: mRNA carries DNA's message to the ribosome.
Step 4: mRNA is translated at the ribosome into a protein by tRNA bringing amino acids to the ribosome.
Vocab: Transcription, Translation, mRNA, tRNA, Central Dogma,
ATTACGATCTGCACAAGATCCT take it to protein.
4.) Translation and Transcription role play with DNA (ATTACGATCTGCACAAGATCCT) codes in groups. Sheet for DNA Helicase, RNA Polymerase, and then ribosome, and tRNA (one carrying methionine/aug, leucine/gac, aspartic acid/gug, valine/uuc, phenylalanine/uuc, and stop/uag.
Tuesday:
Review: Transcription and Translation.
1.) Prior Knowledge Question:
Is all of the DNA in a cell active in coding for protein?
a.) No, only certain parts of the DNA are active, this determines the type of cell.
b.) No, only certain parts of the DNA are active, this is determined by the individual.
c.) Yes, all the DNA is active, this is what makes cells different from one another.
d.) Yes, all the DNA is active, this is what makes individuals different from one another.
2.) Transcription and Translation role play review.
3.) Transcription and Translation worksheet.
Wednesday:
Review: Transcription and Translation computer interactives.
Have competition for
1.) Follow this series of links to work out steps to transcription and translation.
2.) Utah Genetics
3.) Teacher's Domain
4.) Explorelearning.com: Protein Synthesis Use a login and password.
5.) Another Transcription Animation
6.) Another translation animation.
Thursday:
Quiz: Transcription and Translation.
1.) Show the pictures of glowing animals (How? Why?)
2.) Show to the class the paper models for transcription and translation.
3.) Students get a chunk of potato and a little peroxide and make observations and questions about what is going on. What could we do to the potatos to see if they still make bubbles tomorrow?
1.) Introduce enzymes as reactors in a cell.
2.) Hydrogen Peroxide breakdown with potatos, what is happening?
3.) Show a chemical reaction with catalase over the arrow.
4.) What could we do to a potato to see if it still breaks down peroxide? Make a plan and go with this plan to test tomorrow.
Friday:
1.) Molecular Workbench DNA to Protein
2.) Boiled Potatoes, Room Temperature Potatos, vs. Acid Treated Potatos reacting with hydrogen peroxide. Determine the maximum pressure after five minutes for each treatment. In notebook:
3.) Whiteboard the results.
Monday
1.) Raw vs. Baked vs. Vinegar Potatos
2.) Single Gene Mutation Research.
3.) Mutation Type Notes Molecular Workbench.
Friday
Single Gene Mutation Research, find two sources for all information.
Monday
Review
Notes: Type of mutations.
1.) DNA to Protein one sequence using promethean board.
2.) Finish Single Gene Mutation Research.
Tuesday
Connect DNA mutations with the cell cycle. Nobel Prize.
1.) Whiteboarding Poker Review: DNA to mRNA to Protein, HPV to Cancer, Vaccines
Wednesday:
Gene Activation Activity, Poker Review
Thursday:
Test, DNA to mRNA to Protein.
Mouse Gizmo Start.
Friday: Mouse Gizmo Review and Whiteboarding. Genetics Vocab and
Monday: Spongebob Genetics
Tuesday: More genetics/Meiosis
Wednesday: Meiosis Notes/Modeling: Meiosis Races
Thursday: Going through own chromosomes. Cystic Fibrosis Situation.
Friday: Rudolf Graphing,
Monday: Acid River Review
Tuesday: Final Exams
Go Go Stem Cell Activity:
Stem Cell Niches
Steps that occur
Purpose for the stem cell waking up.
Gardasil vaccine steps, reading.
1.) Quick ppt. review of macromolecules
2.) DNA Structure and Function (Put together as two groups racing)
3.) DNA Replication Steps
Monday: Cell Chemistry
1.) DNA Replication Races (Role Play): Replication Vocabulary.
2.) Causes of Mutation-Notes
3.) Break out computers for Nobel Prize DNA Replication races.
4.) Around the Room Macromolecules classification.
Tuesday:
1.) Start Cell Cycle Notes in Notebook Using Flipchart
2.) Vocab and Notes
Wednesday:
1.) Cell Cycle with Paper
2.) Cell Cycle Nobel Prize Interactive
3.) Cell Cycle Role Play
Monday
1.) Cell Cycle with Paper
2.) Cancer Types and steps research
3.) HHMI Videos on Cancer
Tuesday
1.) Individual Cancer Research
2.) Types/Cause/Etc.
Wednesday:
Cell Cycle, Molecule Types, and Cancer Study Guide
Thursday: Cell Cycle and Cancer Test
Friday and Monday
Tay Sachs Disease:
Symptoms: relentless deterioration of mental and physical abilities occurs. The child becomes blind, deaf, and unable to swallow. Muscles begin to atrophy and paralysis sets in. Death usually occurs before the age of 4. What do you think causes this? Most common among Jewish people.
Goal: Students describe how DNA provides template for proteins.
1.) DNA controls a cell, how?
-It uses the force to control actions.
-It provides a code that determines the structure of lipids that control reactions throughout the cell.
-It provides a code that determines the structure of proteins that control reactions throughout the cell.
-It provides a code that determines the structure of carbohydrates the control reactions throughout the cell.
FACTS:
DNA too large to get out of the nucleus. But still controls the cell. How?
2.) Transcription and Translation Videos HHMI.
3.) Translation and Transcription Notes.
Step 1: Cell gets a signal that a certain protein needs to be made.
Step 2: DNA is unwound and transcribed into a mRNA molecule. (gene activation)
Step 3: mRNA carries DNA's message to the ribosome.
Step 4: mRNA is translated at the ribosome into a protein by tRNA bringing amino acids to the ribosome.
Vocab: Transcription, Translation, mRNA, tRNA, Central Dogma,
ATTACGATCTGCACAAGATCCT take it to protein.
4.) Translation and Transcription role play with DNA (ATTACGATCTGCACAAGATCCT) codes in groups. Sheet for DNA Helicase, RNA Polymerase, and then ribosome, and tRNA (one carrying methionine/aug, leucine/gac, aspartic acid/gug, valine/uuc, phenylalanine/uuc, and stop/uag.
Tuesday:
Review: Transcription and Translation.
1.) Prior Knowledge Question:
Is all of the DNA in a cell active in coding for protein?
a.) No, only certain parts of the DNA are active, this determines the type of cell.
b.) No, only certain parts of the DNA are active, this is determined by the individual.
c.) Yes, all the DNA is active, this is what makes cells different from one another.
d.) Yes, all the DNA is active, this is what makes individuals different from one another.
2.) Transcription and Translation role play review.
3.) Transcription and Translation worksheet.
Wednesday:
Review: Transcription and Translation computer interactives.
Have competition for
1.) Follow this series of links to work out steps to transcription and translation.
2.) Utah Genetics
3.) Teacher's Domain
4.) Explorelearning.com: Protein Synthesis Use a login and password.
5.) Another Transcription Animation
6.) Another translation animation.
Thursday:
Quiz: Transcription and Translation.
1.) Show the pictures of glowing animals (How? Why?)
2.) Show to the class the paper models for transcription and translation.
3.) Students get a chunk of potato and a little peroxide and make observations and questions about what is going on. What could we do to the potatos to see if they still make bubbles tomorrow?
1.) Introduce enzymes as reactors in a cell.
2.) Hydrogen Peroxide breakdown with potatos, what is happening?
3.) Show a chemical reaction with catalase over the arrow.
4.) What could we do to a potato to see if it still breaks down peroxide? Make a plan and go with this plan to test tomorrow.
Friday:
1.) Molecular Workbench DNA to Protein
2.) Boiled Potatoes, Room Temperature Potatos, vs. Acid Treated Potatos reacting with hydrogen peroxide. Determine the maximum pressure after five minutes for each treatment. In notebook:
3.) Whiteboard the results.
Monday
1.) Raw vs. Baked vs. Vinegar Potatos
2.) Single Gene Mutation Research.
3.) Mutation Type Notes Molecular Workbench.
Friday
Single Gene Mutation Research, find two sources for all information.
Monday
Review
Notes: Type of mutations.
1.) DNA to Protein one sequence using promethean board.
2.) Finish Single Gene Mutation Research.
Tuesday
Connect DNA mutations with the cell cycle. Nobel Prize.
1.) Whiteboarding Poker Review: DNA to mRNA to Protein, HPV to Cancer, Vaccines
Wednesday:
Gene Activation Activity, Poker Review
Thursday:
Test, DNA to mRNA to Protein.
Mouse Gizmo Start.
Friday: Mouse Gizmo Review and Whiteboarding. Genetics Vocab and
Monday: Spongebob Genetics
Tuesday: More genetics/Meiosis
Wednesday: Meiosis Notes/Modeling: Meiosis Races
Thursday: Going through own chromosomes. Cystic Fibrosis Situation.
Friday: Rudolf Graphing,
Monday: Acid River Review
Tuesday: Final Exams
Go Go Stem Cell Activity:
Stem Cell Niches
Steps that occur
Purpose for the stem cell waking up.
Gardasil vaccine steps, reading.
Subscribe to:
Comments (Atom)