Friday: Cell Chemistry
1.) Quick ppt. review of macromolecules
2.) DNA Structure and Function (Put together as two groups racing)
3.) DNA Replication Steps
Monday: Cell Chemistry
1.) DNA Replication Races (Role Play): Replication Vocabulary.
2.) Causes of Mutation-Notes
3.) Break out computers for Nobel Prize DNA Replication races.
4.) Around the Room Macromolecules classification.
Tuesday:
1.) Start Cell Cycle Notes in Notebook Using Flipchart
2.) Vocab and Notes
Wednesday:
1.) Cell Cycle with Paper
2.) Cell Cycle Nobel Prize Interactive
3.) Cell Cycle Role Play
Monday
1.) Cell Cycle with Paper
2.) Cancer Types and steps research
3.) HHMI Videos on Cancer
Tuesday
1.) Individual Cancer Research
2.) Types/Cause/Etc.
Wednesday:
Cell Cycle, Molecule Types, and Cancer Study Guide
Thursday: Cell Cycle and Cancer Test
Friday and Monday
Tay Sachs Disease:
Symptoms: relentless deterioration of mental and physical abilities occurs. The child becomes blind, deaf, and unable to swallow. Muscles begin to atrophy and paralysis sets in. Death usually occurs before the age of 4. What do you think causes this? Most common among Jewish people.
Goal: Students describe how DNA provides template for proteins.
1.) DNA controls a cell, how?
-It uses the force to control actions.
-It provides a code that determines the structure of lipids that control reactions throughout the cell.
-It provides a code that determines the structure of proteins that control reactions throughout the cell.
-It provides a code that determines the structure of carbohydrates the control reactions throughout the cell.
FACTS:
DNA too large to get out of the nucleus. But still controls the cell. How?
2.) Transcription and Translation Videos HHMI.
3.) Translation and Transcription Notes.
Step 1: Cell gets a signal that a certain protein needs to be made.
Step 2: DNA is unwound and transcribed into a mRNA molecule. (gene activation)
Step 3: mRNA carries DNA's message to the ribosome.
Step 4: mRNA is translated at the ribosome into a protein by tRNA bringing amino acids to the ribosome.
Vocab: Transcription, Translation, mRNA, tRNA, Central Dogma,
ATTACGATCTGCACAAGATCCT take it to protein.
4.) Translation and Transcription role play with DNA (ATTACGATCTGCACAAGATCCT) codes in groups. Sheet for DNA Helicase, RNA Polymerase, and then ribosome, and tRNA (one carrying methionine/aug, leucine/gac, aspartic acid/gug, valine/uuc, phenylalanine/uuc, and stop/uag.
Tuesday:
Review: Transcription and Translation.
1.) Prior Knowledge Question:
Is all of the DNA in a cell active in coding for protein?
a.) No, only certain parts of the DNA are active, this determines the type of cell.
b.) No, only certain parts of the DNA are active, this is determined by the individual.
c.) Yes, all the DNA is active, this is what makes cells different from one another.
d.) Yes, all the DNA is active, this is what makes individuals different from one another.
2.) Transcription and Translation role play review.
3.) Transcription and Translation worksheet.
Wednesday:
Review: Transcription and Translation computer interactives.
Have competition for
1.) Follow this series of links to work out steps to transcription and translation.
2.) Utah Genetics
3.) Teacher's Domain
4.) Explorelearning.com: Protein Synthesis Use a login and password.
5.) Another Transcription Animation
6.) Another translation animation.
Thursday:
Quiz: Transcription and Translation.
1.) Show the pictures of glowing animals (How? Why?)
2.) Show to the class the paper models for transcription and translation.
3.) Students get a chunk of potato and a little peroxide and make observations and questions about what is going on. What could we do to the potatos to see if they still make bubbles tomorrow?
1.) Introduce enzymes as reactors in a cell.
2.) Hydrogen Peroxide breakdown with potatos, what is happening?
3.) Show a chemical reaction with catalase over the arrow.
4.) What could we do to a potato to see if it still breaks down peroxide? Make a plan and go with this plan to test tomorrow.
Friday:
1.) Molecular Workbench DNA to Protein
2.) Boiled Potatoes, Room Temperature Potatos, vs. Acid Treated Potatos reacting with hydrogen peroxide. Determine the maximum pressure after five minutes for each treatment. In notebook:
3.) Whiteboard the results.
Monday
1.) Raw vs. Baked vs. Vinegar Potatos
2.) Single Gene Mutation Research.
3.) Mutation Type Notes Molecular Workbench.
Friday
Single Gene Mutation Research, find two sources for all information.
Monday
Review
Notes: Type of mutations.
1.) DNA to Protein one sequence using promethean board.
2.) Finish Single Gene Mutation Research.
Tuesday
Connect DNA mutations with the cell cycle. Nobel Prize.
1.) Whiteboarding Poker Review: DNA to mRNA to Protein, HPV to Cancer, Vaccines
Wednesday:
Gene Activation Activity, Poker Review
Thursday:
Test, DNA to mRNA to Protein.
Mouse Gizmo Start.
Friday: Mouse Gizmo Review and Whiteboarding. Genetics Vocab and
Monday: Spongebob Genetics
Tuesday: More genetics/Meiosis
Wednesday: Meiosis Notes/Modeling: Meiosis Races
Thursday: Going through own chromosomes. Cystic Fibrosis Situation.
Friday: Rudolf Graphing,
Monday: Acid River Review
Tuesday: Final Exams
Go Go Stem Cell Activity:
Stem Cell Niches
Steps that occur
Purpose for the stem cell waking up.
Gardasil vaccine steps, reading.
No comments:
Post a Comment